Pachet reactivi
Track this opportunity
Register to add pursuits, save this notice, and get alerts when similar tenders appear.
- Save and reuse search filters
- Track opportunities as pursuits
- Get notified when new notices match
Key information
Overview
Pachet reactivi include: 1 x 5100015C - BluCapp centrifuge tubes 15mL, bulk, sterile, 20x25 pcs., Capp AHN, Pret Unitar 292,00 Lei hND1F - CTGATCAGGGTGAGCATCAAA, 25nm, purif. standard desalting, IDTDNA, Pret Unitar 60,00 Lei hND1R - GAATGATGGCTAGGGTGACTTC, 25nm, purif. standard desalting, IDTDNA, Pret Unitar 60,00 Lei hRPP30F - AACTTGTAAGTGGTAGTGCATAGA, 25nm, purif. standard desalting, IDTDNA, Pret Unitar 60,00 Lei hRPP30R - GTAGGAGGACATTTGAGGAGTG, 25nm, purif. standard desalting, IDTDNA, Pret Unitar 60,00 Lei hND1probe - 100 nm PrimeTime™ 5' 6-FAM /3' BHQ®-1, IDTDNA - Pret Unitar 860,00 Lei Sequence: /56-FAM/TG CGA GCA GTA GCC CAA ACA ATC T/3BHQ_1/ Purificare HPLC hRPP30Probe 100 nm PrimeTime™ 5' HEX / 3'BHQ®-1, IDTDNA - Pret Unitar - 990,00 Lei Sequence: /5HEX/TC AGG CAG ACT GAC ACT AGA GTT CAC A/3BHQ_1/ Purificare HPLC Livrare: Depozitul de Chimicale UMF Iasi, max 6 saptamani Plată: OP,Max 30 de zile
26 Sept 2025, 11:37
Publication
26 Sept 2025, 12:16
Deadline
None recorded.